Seudónimo Seudónimo
  • 02-02-2018
  • English
contestada

help me please thank you

help me please thank you class=

Respuesta :

amandinee
amandinee amandinee
  • 02-02-2018
Hello! The answer would be A Luxury

I hope this helped uu!!:)
Answer Link
lindseylu02p3i1t5 lindseylu02p3i1t5
  • 02-02-2018
A Luxury is the correct answer
Answer Link

Otras preguntas

The actions of the pueblo indians at santa fe in 1680 can best be described as:
PLEASE HELP!!!!!!!!!!!!!!! Mongol conquests ranged from East Asia to Eastern Europe during the thirteenth and fourteenth centuries. This relatively short period
crystal lattice definition
what is the value of the expression i × i²× i³× i⁴
Plants absorb nutrients from soil, and nutrients help plants grow. Which level of organization best describes this interaction between plants and soil? communi
The _____________________ solved the most difficult problem of the convention, including how the states would be represented in the new congress.
which of the following harvesting methods is used in large farmhouses a)sickle b)oxen trampling c)combine d)thresher
help me asap !!!!!!!!
what is the relationship between hitech and hipaa
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat