ashleypickard ashleypickard

04-05-2017
Social Studies

contestada

Why was there fear of communism and communist subversion after WWII

Respuesta :

vixenforhim vixenforhim

04-05-2017

Because non-communist governments wanted to control the communism spread and prevent other countries from becoming communist.
It might have been because the style of communism is unfair really.

Answer Link

Otras preguntas

Simplify the function f (x) = f(x)= 1/2 (27)^ 2x/3. Then determine the key aspects of the function.

Where was wheat first domesticated?

23 is between which two prefect squares? Between which two integers is √23

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

Deon made $323 for 17 hours of work. At the same rate, how much would he make for 7 hours?

Which experiences or strenghths did LBG bring to the presidency?

calculate the volume occupied by 0.15mol ofCO2

Q1: Write an algorithm that read a number from the user “assuming the number entered is always between 1-100”, when the number entered is greater than 50, a var

What kind of poem is this that I made. A normal poem or a haiku.

A steady increase in global temperature has been recorded between 1900 and today. Before concluding that this rise in temperature is the result of the increased