Seudónimo Seudónimo
  • 02-03-2017
  • Biology
contestada

How are the processes of natural selection and artificial selection similar? How are they different?

Respuesta :

maxday
maxday maxday
  • 02-03-2017
Artificial and natural selection are really the same process but one is driven by man and the other is driven by an organism's traits that allow them to survive and reproduce. Artificial selection is when mankind chooses certain traits in plants and animals and breeds to enhance that trait.
Answer Link

Otras preguntas

The section of the small intestine between the duodenum and ilium?
Which term refers to the military dictators who took power in Latin America after the Spanish were driven out? A. conquistadores B. creoles C. caudillos D.
What is the primary purpose of the Supremacy Clause?
Express the perimeter of the triangle as a polynomial. 8x+2 5x-4 9x+3
On a map, the distance between two cities is 7.3 centimeters. The map scale is 1 cm:50 km. What is the actual distance between the two cities?
what are 2 examples of ionic compound?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What kind of problems did increased urbanization cause? During time of industrial revolution
a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what
A flatbed truck is loaded 7,000 pounds of bricks. How many tons of bricks are on the truck?