rutu3946 rutu3946

01-11-2021
Mathematics

contestada

The digit 2 in which number represents a value of 20?

Respuesta :

adwright424 adwright424

01-11-2021

Answer:

10

Step-by-step explanation: divide 2 by 20

Answer Link

Otras preguntas

What’s the answer to #12? and why

Which great society program was a comprehensive health insurance program for all senior citizens?

How did censorship and propaganda help fortify post ww1 dictatorships?

Which of the following is true about a writer’s diction? a.When the writer uses sophisticated vocabulary, the diction is informal. b.When the writer uses comple

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

The small organs used by spiders to produce silk are called _____________. silk nozzles spinnerets pedipalps mouthparts

stars and planets are made from gases in a

In 500 words, explain how the characters of Jem and Scout develop over the course of Part I of To Kill a Mockingbird. Discuss how they change and grow and what

What is a sample vs a population

PLEASE HELP ME ASAP Identify the area of the polygon with vertices P (1, 2), Q (1, 4), R (−1, 6), and S (−3, 2).