theoneandonlyjackson theoneandonlyjackson

01-02-2021
Mathematics

contestada

Line v has a slope of 4/9 Line w is parallel to line v. What is the slope of line v?

Respuesta :

birluteijn birluteijn

01-02-2021

Answer:

4/9

Step-by-step explanation:

it is parallel to it ;)

Answer Link

Otras preguntas

How did japan gain territory and control of areas of china during world war 1?

Find the missing length indicated

BC is parallel to DE What is AC? Enter your answer in the box.

What was the main idea of Rousseau's famous work "The Social Contract".

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

How would you describe neville chamberlain's policy toward hitler in the late 1930?

Fill in each blank with mitosis or meiosis. humans produce gametes by the process of __________________. a zygote becomes a fetus by the process of_____________

What is the lowest level of measurement that a median can be computed?

find the greatest common divisor of 9 and 27

What plane contains points C, D, and G? Question 12 options: The plane on the bottom of the figure The plane on the top of the figure The plane on the front sid