Yahgurlally14 Yahgurlally14
  • 01-10-2020
  • History
contestada

How is the modern era different from the post classical era?

Respuesta :

princessash2008
princessash2008 princessash2008
  • 05-10-2020

Answer:

More technology and more developed

Answer Link

Otras preguntas

why is the square root of a perfect square always rational
Companies raise funds to expand their business by
Which powerful religious group often tried to close the theaters in Shakespeare's time? A. the Puritans B. the King's Men C. the Pilgrims D. the Jacobites
Why did the American public mostly oppose joining the League of Nations after WWI?
Express the perimeter of the triangle as a polynomial. 8x+2 5x-4 9x+3
Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea
A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup
Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea