s937581 s937581
  • 03-03-2020
  • History
contestada

what does zyon mean in History

Respuesta :

ortegii2354
ortegii2354 ortegii2354
  • 05-03-2020

The meaning of Zyon is “Uncertain, perhaps dry place”

Answer Link

Otras preguntas

Find the y-intercept of the graph shown. Pls show work!
Musashi Should not increase production from 7 to 8 fire engines. True or False: If Musashi's Fire Engines were a competitive firm instead and $175,000 were the
can a triangle have to acute angles and one obtuse angle
The U.S. Navy has long proposed the construction of extremely low frequency (ELF waves) communications systems; such waves could penetrate the oceans to reach d
How should an animal’s intelligence factor into the way humans treat them?
A number is doubled and then increased by 3. The result is 95. What is the original number?
Question 10 [10 points] The number of frogs in a pond increases continuously at a rate proportional to the number present. There are 150 frogs present at a give
If the pointer in the figure is spun twice, find the probability that the pointer lands on red (R) both spins.
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
What Are anti-federalist's viewpoints on ratifying the constitution?