ryleigh0 ryleigh0
  • 04-09-2019
  • Chemistry
contestada

what in matter can change

Respuesta :

robertkeeney789
robertkeeney789 robertkeeney789
  • 05-09-2019

Answer: The state of the matter.

Explanation: It can change states from a liquid, gas, or a solid.

Answer Link

Otras preguntas

Help with these 4 questions please and thanks!!! 1. Find the radius of the circle x2 + 8x - 4 + y2 + 2y = 12 A. 9 B. 3 C. 5 D. 25 2. Find the center and radius
A mutation that occurs in the gametes of an organism will most likely be transferred where
SECTION 1 OF 1 1234567891011121314 Consider the following three statements: As children grow older, their weight increases. As children grow older, they expand
the value x+x(x×) when x = 2
Find the length of the missing side of a right triangle if a=6 and c=11
Name all of the traits that the mackerel has, based on this cladogram.
What is mitochondria
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
How do you find x ????
You draw two cards from a standard deck of 52 cards, but before you draw the second card, you put the first one back and reshuffle the deck. (a) are the outcome