Seudónimo Seudónimo
  • 03-09-2019
  • Mathematics
contestada

Mrs.Gardener needs to pay $1098 each month for 52 months to pay off loan. How much money does she need to pay in total¿

Respuesta :

parmveerv
parmveerv parmveerv
  • 03-09-2019
I got $57,096 as my answer
Answer Link

Otras preguntas

20 points People disagree whether the United States should have gone to war against Mexico. Should the United States have declared war? Opinions Please The Unit
in what area of Europe were the majority of warsaw pact countries
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
how would u form a superlative for the adverb widely
what is the most common type of vegetation throughout Latin America
On Being Brought from Africa to America by Phillis Wheatley 'Twas mercy brought me from my Pagan land, Taught my benighted soul to understand That there's a God
On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor
amy wants to carpet a room that is 12 feet by 8 feet. how many square yards of carpet will she need to complete the room?
The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The
What kind of problems did increased urbanization cause? During time of industrial revolution