deneecan
deneecan
05-04-2019
Mathematics
contestada
Write a fraction that is equivalent to 8
Respuesta :
2Thea12Maine6
2Thea12Maine6
05-04-2019
8/1 or 16/2 or 24/3 or 32/4 or 40/5
Answer Link
VER TODAS LAS RESPUESTAS ( 26+ )
Otras preguntas
The following accounts were taken from the financial statements of Lee Company. Match each of the accounts to its proper balance sheet classification. If the it
Justin wants to teach a hip-hop dance workshop. The cost of renting a dance studio is $149.50 plus $13 per person attending the workshop. Just can spend $323 at
Allison needed to get her computer fixed. She took it to the repair store. The technician at the store worked on the computer for 4.25 hours and charged her $17
Suppose you send about 12 text messages a day, and your older sister sends more text messages than you do. Together, you send a total of about 26 messages per d
One of these expressions reduces to 1 and the other reduces to –1. Do you know which one is which? How do you know? x + 3 3 + x 3 − x x − 3 x + 3 3 + x = The nu
A car weighs 11000 N on Earth. What is its mass? A) 300 kg B) 1122 kg C) 0 kg D) 107,800 kg
please help me with this question for history
How Did you feel the Compromise of 1850 was effective and appropriate? Explain why you feel that way.
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
Which phrase correctly completes this conversation? Jean: Est-ce que tu as le livre de Molière? Renard: Non, je _________ à Marie avant hier. A. ai prêté B. l'a
