kcnawlay170
kcnawlay170 kcnawlay170
  • 02-04-2019
  • Mathematics
contestada

what is a reasonable rage for this situation?

what is a reasonable rage for this situation class=
what is a reasonable rage for this situation class=

Respuesta :

ashleyschaper ashleyschaper
  • 02-04-2019

Answer:

Root is x=16 Domain and Range would be all real numbers

Step-by-step explanation:

Answer Link

Otras preguntas

Which sentence best describes how a business letter should be written? A business letter should have its body aligned to the right margin of the page. A busines
Write one or two sentences about the main idea or purpose of the article.
If you attended the us public high school the highest status crowds were probably the
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
The sterile material that is placed directly on a wound is termed​ the:
Solve for x in terms of the other matrices and/or their inverses. x=b+ax
The molarity of a solution that contains 0.50 moles of naoh in 200.0 milliliters of water is
The term used when an organism is studied in its natural environment is
Name the five transport mechanisms of the cell:
find the greatest common divisor of 9 and 27